Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0044520 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Laryngeal Squamous Cell Carcinoma | ICD-10 | - (-) |
DBLink | PMID | 30282067 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | LSCC and paired normal laryngeal tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CTGGCAAAGATGGACTCAAC ReverseCTTAGCACCAACAGCACCAG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Fan, Y, Xia, X, Zhu, Y, Diao, W, Zhu, X, Gao, Z, Chen, X (2018). Circular RNA Expression Profile in Laryngeal Squamous Cell Carcinoma Revealed by Microarray. Cell. Physiol. Biochem., 50, 1:342-352. |