circad | circRNAs associated with diseases

hsa_circ_0044520
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Laryngeal Squamous Cell Carcinoma	ICD-10	- (-)
DBLink		PMID	30282067
Experimental Method
Sample Type	Tissue and cell lines	Comparison	LSCC and paired normal laryngeal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTGGCAAAGATGGACTCAAC Reverse CTTAGCACCAACAGCACCAG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Fan, Y, Xia, X, Zhu, Y, Diao, W, Zhu, X, Gao, Z, Chen, X (2018). Circular RNA Expression Profile in Laryngeal Squamous Cell Carcinoma Revealed by Microarray. Cell. Physiol. Biochem., 50, 1:342-352.